Background Diabetic education can have significant effects in improving glycemic markers in
patients with diabetes. This study sought to determine if the Diabetes Boot Camp, a novel 2-…

Close communication between nephrology staff, dieticians, and pediatric staff led to the
successful dialysis treatment and nutritional support of a premature infant born with kidney …

A case is presented of a child presenting to the pediatric clinic with his parents to discuss
renal replacement therapy; in addition to kidney problems, the child was obese, had a …

… ‐3′ and MLB16, 5′‐GGCTGCTGGCACGTAGTTAG‐3′) were used to amplify the variable
V1 region of the 16S ribosomal RNA gene according to Hebert et al. (25). PCR products …

… The great complexity and the wide range of peptide abundance in these products severely
challenge the capabilities of existing analytical methodologies. A major step forward in this …

… Hebert-Leiter examines the entire history of the Acadian, or … in Acadian characters, but as
Hebert-Leiter shows, the ambiguity of … Hebert-Leiter explores this transition in Ernest Gaines's …

Public budgeting and finance is a discipline that encompasses communities of research
and practice. Too often, however, these communities fail to engage each other, instead …

The accumulation of radioactive somatostatin analog [111In] pentetreotide in non-small cell
lung cancer (non-SCLC) during scintigraphy of patients provides a rationale for investigating …

The Journals of Gerontology, Series A: Biological Sciences publishes articles on the biological
aspects of aging in areas such as biochemistry, biodemography, cellular and molecular …

Conservation and sustainable management of aquatic ecosystems is a priority in environmental
programs worldwide. However, these aims are highly dependent on the efficiency, …